Thread: problem z testami "ocen"

Czy dla testu 2 ocen możliwe jest rozwiązanie:
TTGTAGTGGTACAATGTTAAACCG
bo sprawdzając manualnie wydaje mi się że tak, a na sio2 mam "zła odpowiedź".
Wysyłałem kod który dla wszystkich testów wypisał tą odpowiedź, więc błędna jest albo odpowiedź albo sędzia z sio2.
Więc proszę o sprawdzenie mojej odpowiedzi.
Moja testerka też odrzuca to rozwiązanie. Z tego co widzę to odpowiedź do ocen2 powinna być równa pierwszemu słowu, czyli niemożliwe jest, żeby był też inny poprawny wynik.
Co więcej, dokładnie to jest napisane w treści zadania.